Re: Animal 'bar codes' to take over from Latin names

[philidor11@snet.net]

From:  Animal 'bar codes' to take over from Latin names

Today 40 leading scientists involved in taxonomy ~ the classification 
of 
organisms ~ will meet in New York with the aim of setting up 
an 
international bar-coding system using individual DNA as labels 
for new 
species. Existing species will get their own bar code, too.
...
DNA is also encoded, using four chemical bases ~ adenine (A), 
cytosine 
(C), guanine (G) and thymine (T) ~ and the genomes of most species 
are 
millions of these nucleotides long. The sequence for every living 
organism 
is different, and just using a fraction of the sequence would 
provide more 
than one billion bar code options.
...
Although new species may have a bar code only, existing species 
will keep 
their Latin names too. The bar code for an African elephant (Loxodonta 

africana), for example, would be made up of thick and thin lines 

representing the four chemical bases using the letters 
AACACTGTATCTATTATTTG, while the domestic cat would be TACTCTTTACCTTTTATTCG.

Dr Richard Thomas, of the Natural History Museum, and co-author 
of a 
report published this week in Trends in Ecology and Evolution, 
said:
... 
"Another advantage of bar codes is that the information is digital 
and not 
influenced by subjective assessments. It would be reproducible 
at any time 
and by any person, speaking any language."

Commented HP Orenstein:

Well, this should be fun for palaeontologists....


But the advantage is it meets the most important criteria for 
a name:  stability and universality.  No theoretical, subjective 
intervention.  Still, there'll always be room for genus and species, 
and families and ranks and orders, and the whole panoply of organizing 
ideas that allow an easier grasp by minds more in tune with a 
kind of narrative than with an agglomeration of capital letters.
Just means in the listing of species, those 'belonging' to paleontologists 
will have a section of the page designated Terra Incognita.






___________________________________________________________
Sent by ePrompter, the premier email notification software.
Free download at http://www.ePrompter.com.